View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1432_low_16 (Length: 230)

Name: NF1432_low_16
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1432_low_16
NF1432_low_16
[»] chr5 (1 HSPs)
chr5 (16-80)||(26558385-26558449)
[»] chr8 (1 HSPs)
chr8 (171-210)||(1277528-1277567)


Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 26558449 - 26558385
Alignment:
16 aaaggctgatattattttgtgggttttcatgcaataacatatcgcaccaacaagcttttgccttt 80  Q
    ||||||||||||||||| || ||||||| |||| |||||| |||||||||||| ||||| |||||    
26558449 aaaggctgatattatttcgttggttttcgtgcactaacatgtcgcaccaacaaactttttccttt 26558385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 210
Target Start/End: Original strand, 1277528 - 1277567
Alignment:
171 tatatgctgaccttaaagcttgagaaaataaccgggtgaa 210  Q
    ||||||||||||||||||||||||||||| ||||||||||    
1277528 tatatgctgaccttaaagcttgagaaaatgaccgggtgaa 1277567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University