View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1432_low_16 (Length: 230)
Name: NF1432_low_16
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1432_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 26558449 - 26558385
Alignment:
| Q |
16 |
aaaggctgatattattttgtgggttttcatgcaataacatatcgcaccaacaagcttttgccttt |
80 |
Q |
| |
|
||||||||||||||||| || ||||||| |||| |||||| |||||||||||| ||||| ||||| |
|
|
| T |
26558449 |
aaaggctgatattatttcgttggttttcgtgcactaacatgtcgcaccaacaaactttttccttt |
26558385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 171 - 210
Target Start/End: Original strand, 1277528 - 1277567
Alignment:
| Q |
171 |
tatatgctgaccttaaagcttgagaaaataaccgggtgaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1277528 |
tatatgctgaccttaaagcttgagaaaatgaccgggtgaa |
1277567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University