View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1432_low_17 (Length: 221)
Name: NF1432_low_17
Description: NF1432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1432_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 144
Target Start/End: Original strand, 29090866 - 29090992
Alignment:
| Q |
18 |
gtatgatgagttggatttttggaagcttctgattatgaatgagaggtattattattgtttgcaagagtaaatatggagaaaaatgtgagtacttttcaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29090866 |
gtatgatgagttggatttttggaagcttctgattatgaatgagaggtattattattgtttgcaagagtaaatatggagaaaaatgtgagtacttttcaca |
29090965 |
T |
|
| Q |
118 |
taaatggaggaggatcaccccactacc |
144 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29090966 |
taaatggaggaggatcaccccactacc |
29090992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 29085179 - 29085219
Alignment:
| Q |
57 |
tgagaggtattattattgtttgcaagagtaaatatggagaa |
97 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29085179 |
tgagtggtattattattgtttgaaagagtaaatatggagaa |
29085219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University