View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_high_16 (Length: 254)
Name: NF14331_high_16
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 52294674 - 52294463
Alignment:
| Q |
19 |
acatcagataaagaacgcggatagataagaacttatagtgcaaaagccaaggatttgccttgttcatctggatttagtgcttgttttgaaatgtttatcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52294674 |
acatcagataaagaacgcggatagataagaacttgtagtgcaaaagccaaggatttgccttgttcatctggatttagtgcttgtttcgaaatgtttatcg |
52294575 |
T |
 |
| Q |
119 |
ggtctgcaggaagaaactgttgtaactttgctannnnnnnaaaactacaaaaatgtctttatgaaatcaattaattaaacatacatttgacttgttttcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52294574 |
ggtctgcaggaagaaactgttgtaactttgctattttttgaaaactacaaaaatgtcttta-------aattaattaaacatacatttgacttgttttcc |
52294482 |
T |
 |
| Q |
219 |
aagtttattcaataatatt |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52294481 |
aagtttattcaataatatt |
52294463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University