View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_high_19 (Length: 214)
Name: NF14331_high_19
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 47 - 198
Target Start/End: Original strand, 25030779 - 25030930
Alignment:
| Q |
47 |
aaagcctctttgctgttgaccttagttagaagttcctgcaannnnnnngtgtaagtctcaattataatctcaatatcaagacggcgaactgcttcaatag |
146 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25030779 |
aaagcctctttggtgttgaccttagttagaagttcctgtaatttttttttgtaagtctcaattataatctcaatatcaagacggcgaactgcttcgatag |
25030878 |
T |
 |
| Q |
147 |
tatactctgtgtgtcttcgtttctttggagcaggcggaggcgatggggtttc |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25030879 |
tatgctctgtgtgtcttcgtttctttggagcaggcggaggcgatggggtttc |
25030930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University