View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_high_7 (Length: 434)
Name: NF14331_high_7
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 3e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 187 - 406
Target Start/End: Complemental strand, 4366615 - 4366400
Alignment:
| Q |
187 |
aatcgccatttatgtgcacaactttatagactattatcttgagtatgtcggataaaactgtaataatgataaagctctccatcgacaaaatttaatacca |
286 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
4366615 |
aatcgccatttatgtgcccaactttatagactattatcttgagtatgtcggataaaactgtaataatgataaagctctcgatcgacaaaatttaat---a |
4366519 |
T |
|
| Q |
287 |
gtaatagcggtatttgtatatcattcgataaagaaatcatcacattgatagtggaatcttttgtctttaaatatatggttatattaacaattgtttttaa |
386 |
Q |
| |
|
||||||| |||||||||| |||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4366518 |
gtaatagaggtatttgtagatcatt-aataaaaaaatcatcacattgatagtggaatcttttctctttaaatatatagttatattaacaattgtttttaa |
4366420 |
T |
|
| Q |
387 |
gtttggagaaaaattaacaa |
406 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
4366419 |
gtttagagaaaaattaacaa |
4366400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 78 - 117
Target Start/End: Complemental strand, 4366723 - 4366684
Alignment:
| Q |
78 |
gctttttggtacttgttgtactaagacacagaacacgagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4366723 |
gctttttggtacttgttgtactaagacacagaacacgagg |
4366684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University