View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_low_11 (Length: 350)
Name: NF14331_low_11
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 181 - 292
Target Start/End: Original strand, 52294311 - 52294420
Alignment:
| Q |
181 |
ctggcataatccaagtgataagaaatgaagaattgcaagttcgaacatggacttatcgaatccacactccatcatttcatacgtctttacaatatatttt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52294311 |
ctggcataatccaagtgataagaaatgaagaattgcaagtttgaacatggacttatcgaatccacactccatcatttcatacgtctttaca--atatttt |
52294408 |
T |
|
| Q |
281 |
atgatctcaata |
292 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52294409 |
atgatctcaata |
52294420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 311 - 350
Target Start/End: Original strand, 52294442 - 52294481
Alignment:
| Q |
311 |
gaaaactcggatgatctcaataatattattgaataaactt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52294442 |
gaaaactcggatgatctcaataatattattgaataaactt |
52294481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 158
Target Start/End: Original strand, 52294278 - 52294321
Alignment:
| Q |
117 |
ttatctagtatcaaagagtata--gtagtaaaactggcataatc |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52294278 |
ttatctagtatcaaagagtatatagtagtaaaactggcataatc |
52294321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University