View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_low_12 (Length: 341)
Name: NF14331_low_12
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 30 - 327
Target Start/End: Complemental strand, 22313093 - 22312794
Alignment:
| Q |
30 |
attttaatttgattcttatttgtgaaattaaagtgttaccaaattcatttatcacttttgtgttctttatcacttt-gtgttctttcggtgttttggtac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22313093 |
attttaatttgattcttatttgtgaaattaaaatgttaccaaattcatttaaattcattgtgttctttatcacttttgtgttctttcggtgttttggtac |
22312994 |
T |
|
| Q |
129 |
atatgctttactgtttcggtggtcagtaccaaatgactaaaataacctttcttttggggtattatagtcattctagcacttttt-cactttagtactttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22312993 |
atatgctttactgtttcggtggtcagtgccaaatgactaaaataacctttcttttggggtattatagtcattctagcacttttttcactttagtactttg |
22312894 |
T |
|
| Q |
228 |
agggtatgttagtaattatctatcttatagaaaaatacataattccggaaaatgtggatttatagtcagaagaaacatctttaacagttccatacctatg |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22312893 |
agggtatgttagtaattatctatcttatagaaaaatacataattccggaaaatctggatttatagtcagaagaaacatctttaacagttccatacctatg |
22312794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University