View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_low_14 (Length: 280)
Name: NF14331_low_14
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 151 - 258
Target Start/End: Original strand, 4968039 - 4968146
Alignment:
| Q |
151 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgctctaaaaccacaagatgctgatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4968039 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgctctaaaaccacaagatgttgatc |
4968138 |
T |
 |
| Q |
251 |
cattagct |
258 |
Q |
| |
|
|||||||| |
|
|
| T |
4968139 |
cattagct |
4968146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 4967888 - 4967922
Alignment:
| Q |
1 |
aagcaaagtcattaatcattatgattaatgacacc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4967888 |
aagcaaagtcattaatcattatgattaatgacacc |
4967922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 151 - 258
Target Start/End: Original strand, 17859508 - 17859615
Alignment:
| Q |
151 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgctctaaaaccacaagatgctgatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
17859508 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgctctaacaccacaagatgttgatc |
17859607 |
T |
 |
| Q |
251 |
cattagct |
258 |
Q |
| |
|
|||||||| |
|
|
| T |
17859608 |
cattagct |
17859615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 17859357 - 17859391
Alignment:
| Q |
1 |
aagcaaagtcattaatcattatgattaatgacacc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17859357 |
aagcaaagtcattaatcattatgattaatgacacc |
17859391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 151 - 258
Target Start/End: Complemental strand, 34916304 - 34916197
Alignment:
| Q |
151 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgctctaaaaccacaagatgctgatc |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
34916304 |
cactaacattagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgctctaacaccacaagatgttgatc |
34916205 |
T |
 |
| Q |
251 |
cattagct |
258 |
Q |
| |
|
|||||||| |
|
|
| T |
34916204 |
cattagct |
34916197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 34916455 - 34916421
Alignment:
| Q |
1 |
aagcaaagtcattaatcattatgattaatgacacc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34916455 |
aagcaaagtcattaatcattatgattaatgacacc |
34916421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University