View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_low_18 (Length: 243)
Name: NF14331_low_18
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_low_18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 25030505 - 25030747
Alignment:
| Q |
1 |
aacttgttacccaccatgtttttgagatgttggctctcctgtggtacttgcagagactccgacgatcaagttagtaaagaattcaataacaggacaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25030505 |
aacttgttacccaccatgtttttgagatgttggctctcctgtggtacttgcagagactccgacgatcaagttagtaaagaattcaataacaggacaataa |
25030604 |
T |
|
| Q |
101 |
ttttgatnnnnnnnngaacagatcatgcattaataattaagaaatgaagattaaccatggtaaatttgttcatacctttcttacctacacagaagcagcg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25030605 |
ttttgataaaaataagaacagatcatgcattaataattaacaaatgaagattaaccatggtaaatttgttcttacctttcttacctacacagaagcagcg |
25030704 |
T |
|
| Q |
201 |
atttattataaatttgttaccattcttaacggagtgacatcaa |
243 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25030705 |
atttattataaatttgttacctttcttaacggagtgacatcaa |
25030747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University