View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_low_19 (Length: 230)
Name: NF14331_low_19
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 50407986 - 50408183
Alignment:
| Q |
18 |
aggttcatcttaaagagtaaggaacagtgacgaaatacttttcccctacacaagtaaatgggtatgacttggataattcttatcttgagataagaggaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50407986 |
aggttcatcttaaagagtaaggaacagtgacgaaatacttttcccctacacaagtaaatgggtatgacttggataattcttatcttcagataagaggaaa |
50408085 |
T |
 |
| Q |
118 |
acctgttatcggttttaactcaaaattcttcttcttcactaaaaggaaaaggaaaagtggaaaattcgatggtatcaactaccaaccaaccaaatact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50408086 |
acctgttatcggttttaactcaaaattcttcttcttcactaaaaggaaaaggaaaagtggaaaattcgatggtatcaactaccaaccaaccaaatact |
50408183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University