View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14331_low_21 (Length: 202)
Name: NF14331_low_21
Description: NF14331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14331_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 32147837 - 32147671
Alignment:
| Q |
18 |
agataagtacggttgatccttacacagttttagaagcttctatttacaaagcagttacagacgctttcgtgaaagcatctgctgcaagaaacataaaaag |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32147837 |
agataagtaccgttgatccttacacagttttggaagcttctatttacaaagcagttacagacgctttcgtgaaagcgtctgctgcaagaaacataaaaag |
32147738 |
T |
 |
| Q |
118 |
ggtggattcggttgcaccttttgagttttgttacactaatgtgactgggacacgattgggtgcggat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32147737 |
ggtggattcggttgcaccttttgagttttgttacactaatgtgactgggacacgattgggtgcggat |
32147671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 32138447 - 32138285
Alignment:
| Q |
18 |
agataagtacggttgatccttacacagttttagaagcttctatttacaaagcagttacagacgctttcgtgaaagcatctgctgcaagaaacataaaaag |
117 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
32138447 |
agattagtacggttgatccttacacggttttagaagcttctatttacaaagcagttacagacgctttcgtgaaagcgtctgctgcaagaaacataaagag |
32138348 |
T |
 |
| Q |
118 |
ggtggattcggttgcaccttttgagttttgttacactaatgtgactgggacacgattgggtgc |
180 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32138347 |
ggtgggttcggttgcgccttttgaattttgttacactaatttgactgggacacgattgggtgc |
32138285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 18 - 113
Target Start/End: Complemental strand, 32126646 - 32126551
Alignment:
| Q |
18 |
agataagtacggttgatccttacacagttttagaagcttctatttacaaagcagttacagacgctttcgtgaaagcatctgctgcaagaaacataa |
113 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
32126646 |
agattagtacggttgatccttacacggttctagaagcttctatttacaaagcagttacagacgcttttgtgaaagcatctgttgcaagaaacataa |
32126551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University