View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_high_14 (Length: 385)
Name: NF14332_high_14
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 146 - 369
Target Start/End: Original strand, 5898521 - 5898744
Alignment:
| Q |
146 |
gtggaattgaatttctttacacaatagtcaaaatttggaaccgttctagaaagcaaccttatggaagagtcgagttttgcgtgtcttatggtcttcttct |
245 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5898521 |
gtggaattgaattcctttacacaatagtcaaaatttggaaccgttctagaaagcaaccttatggaagagtcgagttttgcgtgtcttatggtcttcttct |
5898620 |
T |
 |
| Q |
246 |
cctatttgaacactctcaaatgaataaatagcattaatatatatattagtagaagtaaattagtaggaaataaaagacctttgaaagattaagaatatac |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5898621 |
cctatttgaacactctcaaatgaataaatagcattaatatatatattagtagaagtaaagtagtaggaaataaaagacctttgaaagattaagaatatac |
5898720 |
T |
 |
| Q |
346 |
aaacaaaaggatatggcatgttct |
369 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5898721 |
aaacaaaaggatatggcatgttct |
5898744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 5898376 - 5898485
Alignment:
| Q |
1 |
ttgctttttggtttttgttacaattgccgtgagcatgaagtttgaagtagtcaatgcacgttccatttccaagtctttattcattttatatattattata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5898376 |
ttgctttttggtttttgttacaattgccgtgagcatgaagtttgaagtagtcaatgcacgttccatttccaagtctttattcattttgtatattattata |
5898475 |
T |
 |
| Q |
101 |
tctgtggttt |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
5898476 |
tctgtggttt |
5898485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University