View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_high_19 (Length: 346)
Name: NF14332_high_19
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 169 - 332
Target Start/End: Complemental strand, 44750093 - 44749930
Alignment:
| Q |
169 |
attttttgtcgctttaacatgcttacgtagatgtggcatggaatgtgcaactcttttcatgctgcaagtattatatatagaaggactagtttgttctttt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
44750093 |
attttttgtcgctttaacatgcttacgtagatgtggcatggaatgtgcaactcttttcatgctgcaagtattatatatagaagggctagttagttctttt |
44749994 |
T |
|
| Q |
269 |
attttatgcgtctaagatgacaacaacaatctcatcttaatatcagtggtagatctttagttat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44749993 |
attttatgcgtctaagatgacaacaacaatctcatcttaatatcagtggtagatctttagttat |
44749930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 18 - 138
Target Start/End: Complemental strand, 44750251 - 44750135
Alignment:
| Q |
18 |
caaatggggcatgaaacnnnnnnnttgctctttaggttttacttactactgtttccttaaggatcctcaagtgaccgtttattgtcgtttcggatcaaaa |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750251 |
caaatggggcatgaaacaaaaaaattgctctttaggttttact----actgtttccttaaggatcctcaagtgaccgtttattgtcgtttcggatcaaaa |
44750156 |
T |
|
| Q |
118 |
gtccaaacctgcgtatttagg |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44750155 |
gtccaaacctgcgtatttagg |
44750135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 204 - 300
Target Start/End: Original strand, 24198589 - 24198685
Alignment:
| Q |
204 |
gcatggaatgtgcaactcttttcatgctgcaagtattatatatagaaggactagtttgttcttttattttatgcgtctaagatgacaacaacaatct |
300 |
Q |
| |
|
||||| || |||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
24198589 |
gcatgaaacgtgcaactcttttcattctgcaagtattgtatatagaagggctagtttgttcttttgttttatgctgctaagatgataacaacaatct |
24198685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 299
Target Start/End: Original strand, 50197403 - 50197448
Alignment:
| Q |
254 |
ctagtttgttcttttattttatgcgtctaagatgacaacaacaatc |
299 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
50197403 |
ctagtttgttcttttgttttatgcaactatgatgacaacaacaatc |
50197448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University