View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14332_high_21 (Length: 271)

Name: NF14332_high_21
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14332_high_21
NF14332_high_21
[»] chr3 (1 HSPs)
chr3 (45-249)||(51845851-51846055)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 45 - 249
Target Start/End: Original strand, 51845851 - 51846055
Alignment:
45 gaggttgataacaggaaatgtaaggagcgagcgaacgatggtgcagatcgacgacgatagctatagctattcagtgtagatcgatagcaatcgctatggg 144  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
51845851 gaggttgataccaggaaatgtaaggagcgagcgaacgatggtgcagatcgacgacgatagctatagctattcagtgtagatcgagagcaatcgctatggg 51845950  T
145 agaccggagaataacggttttaggtttgggtttgagtgagagtgatggtaaacctaatagcccccattcgtggtgattcggagtggttagatacttatgc 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| || ||||| |    
51845951 agaccggagaataacggttttaggtttgggtttgagtgagagtgatggtaaacctaatagcccccattcgtggtgattgggaatggttaaatccttatcc 51846050  T
245 accgt 249  Q
    |||||    
51846051 accgt 51846055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University