View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_high_22 (Length: 264)
Name: NF14332_high_22
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 228
Target Start/End: Original strand, 15306293 - 15306505
Alignment:
| Q |
16 |
gtgttgactgaccactgactgcatttaatccaagttcatgttatacctgtgtgttcaatgttgattattgagcttagaattatgattctaatgaagcgga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15306293 |
gtgttgactgaccactgactgcatttaatccaagttcatgttatacctgcgtgttcaatgttgattgttgagcttagaattatgattctaatgaagcgga |
15306392 |
T |
|
| Q |
116 |
ggcaataatgcttggttttcaacattacttggtgatgttgggcacaactgttttgataccaactgctctagtttcacagatgggaggaggaaatgtaagt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15306393 |
ggcaataatgcttggttttcaacattacttggtgatgttgggcacaactgttttgataccaactgctctagtttcacagatgggaggaggaaatgtaagt |
15306492 |
T |
|
| Q |
216 |
cttgatgtgtaag |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15306493 |
cttgatgtgtaag |
15306505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 218
Target Start/End: Complemental strand, 26475396 - 26475282
Alignment:
| Q |
104 |
taatgaagcggaggcaataatgcttggttttcaacattacttggtgatgttgggcacaactgttttgataccaactgctctagtttcacagatgggagga |
203 |
Q |
| |
|
||||||||| |||||||| | |||||||||||||||||| | |||||| | || ||||||||| | || |||| |||||||| | |||||||||||| |
|
|
| T |
26475396 |
taatgaagccgaggcaatcctacttggttttcaacattaccttgtgatgcttggtacaactgttctaattccaagctctctagttcctcagatgggagga |
26475297 |
T |
|
| Q |
204 |
ggaaatgtaagtctt |
218 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26475296 |
ggaaatgtaagtctt |
26475282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University