View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_high_28 (Length: 227)
Name: NF14332_high_28
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 36060813 - 36060619
Alignment:
| Q |
18 |
acaacaaacagcttttggtcatgtcctttattaacttcgagagaataaaacattatcacctgcttgcctaaaagtgctaagacagaaaagctactttaac |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36060813 |
acaataaacagcttttggtcatgtcctttattaacttcgagagaataaaacattattacctgcttgcctaaaagtgctaagacagaaaagctactttaac |
36060714 |
T |
|
| Q |
118 |
ggggaagatagagagatgagtgtggaactgaaacatgcattagcatgatgaaaagcnnnnnnnnttattaagtacttgcatgtttctaagtataa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
36060713 |
ggggaagatagagagatgagtgtggaactgaaacatgcattagcatgatgaaaagcaaaaaaaattattaagtacttgcatgtctctaagtataa |
36060619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University