View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_high_29 (Length: 227)
Name: NF14332_high_29
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 41291813 - 41292008
Alignment:
| Q |
14 |
tgaaatgaatctcagacattgatcctgtaattaatgaaagctgcttcttttctgtttggctcttgcatgctttacctacttcagcataacgagcagtaac |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41291813 |
tgaactgaatctcagacattgatcctgtaattaatgaaagctgcttcttttctgtttggctcttgcatgctttacctacttcagcataacgagcagtaac |
41291912 |
T |
|
| Q |
114 |
cctagctagcatagtaggattaggatggtcctaaccaataaccacaaatatactactattgtacgagtaaataaagttatttttatacacataaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41291913 |
cctagctagcatagtaggattaggatggtcctaaccaataaccacaaatatactactattgtacgagtaaataaagttatttttatacacataaag |
41292008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University