View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_low_21 (Length: 310)
Name: NF14332_low_21
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 291
Target Start/End: Complemental strand, 24700540 - 24700262
Alignment:
| Q |
13 |
gggggttatgtgaaggttgggagttccgtggaagcggttaagatatttaatgaaatgcggcatcaaaatattggtatagactttattgtgtttgtaaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24700540 |
gggggttatgtgaaggttgggagttccgtggaagcggttaagttatttaatgaaatgcagcatcaaaatattggtttagactttattgtgtttgtaaatc |
24700441 |
T |
 |
| Q |
113 |
ttgtttccggttgcatacatttaagggagcgattgttagcttcatctgttcactctcttgtactcaaatgcgggtgtcatgaagaagattccattaaaaa |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24700440 |
ttgtttccggttgcatacagttaagggagcaattgttagcttcatctgttcactctcttgtactcaaatgtgggtgtcatgaagaagattccattaaaaa |
24700341 |
T |
 |
| Q |
213 |
cttgcttctaactatgtacgcacgctgtggtaaccttacctctgctagaataatatttgatctgatcgttcgaaagagt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24700340 |
cttgcttctaactatgtacgcacgctgtggtaaccttacctctgctagaataatatttgatctgatcgttcgaaagagt |
24700262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University