View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_low_24 (Length: 271)
Name: NF14332_low_24
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 45 - 249
Target Start/End: Original strand, 51845851 - 51846055
Alignment:
| Q |
45 |
gaggttgataacaggaaatgtaaggagcgagcgaacgatggtgcagatcgacgacgatagctatagctattcagtgtagatcgatagcaatcgctatggg |
144 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51845851 |
gaggttgataccaggaaatgtaaggagcgagcgaacgatggtgcagatcgacgacgatagctatagctattcagtgtagatcgagagcaatcgctatggg |
51845950 |
T |
 |
| Q |
145 |
agaccggagaataacggttttaggtttgggtttgagtgagagtgatggtaaacctaatagcccccattcgtggtgattcggagtggttagatacttatgc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| || ||||| | |
|
|
| T |
51845951 |
agaccggagaataacggttttaggtttgggtttgagtgagagtgatggtaaacctaatagcccccattcgtggtgattgggaatggttaaatccttatcc |
51846050 |
T |
 |
| Q |
245 |
accgt |
249 |
Q |
| |
|
||||| |
|
|
| T |
51846051 |
accgt |
51846055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University