View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_low_26 (Length: 262)
Name: NF14332_low_26
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 10829560 - 10829324
Alignment:
| Q |
18 |
atcttcgaatcagaatgcgatactcgacggattagctacgagaacagtaaaacgaaacttcgattagcaatggtgaatcgcgtgcggaatgaaatcggaa |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10829560 |
atcttcgaatcagaatgcaatactcgacggattagctacgagaacagtaaaacgaaacttcgattagcaatggtgaatcgcgtgcggaatgaaatcggaa |
10829461 |
T |
 |
| Q |
118 |
tctgataaattcccttaccctcgtttcttgttgatgaatgaagaaatgaatgagagtgtagtgtgatgagtaatgacggttacaaatagaatcgtcctac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10829460 |
tctgataaattcccttaccctcgtttcttgttgatgaatgaagaaatgaatgagagtgtagtgtgatgagtaatgacggttacaaatagaaccgtcctac |
10829361 |
T |
 |
| Q |
218 |
ttatactagcaaccaacaacaggtttttattcttttc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10829360 |
ttatactagcaaccaacaacaggtttttattcttttc |
10829324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University