View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_low_30 (Length: 239)
Name: NF14332_low_30
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 5 - 200
Target Start/End: Complemental strand, 7451259 - 7451064
Alignment:
| Q |
5 |
gggcattagcttaatttgttcatcactgtctagctctaacttcgaggttgagagactagagtggctcacacacccccacgaaatatgaaccaatcactcc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451259 |
gggcattagcttaatttgttcatcactgtctagctctaacttcgaggttgagagactagagtggctcacacacccccacgaaatatgaaccaatcactcc |
7451160 |
T |
|
| Q |
105 |
aaagtgcatggaccaaggtagtgtccttggttcttgaaatctttttgaaaattttcttataaataggaccgaagagaatattagatcaatcatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
7451159 |
aaagtgcatggaccaaggtagtgtccttggttcttgagatctttttgaaaattttcttataaataggatcgaagaaaatattagatcaatcatttt |
7451064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 7437839 - 7437753
Alignment:
| Q |
35 |
tagctctaacttcgaggttgagagactagagtggctcacacacccccacgaaatatgaaccaatcactccaaagtgcatggaccaagg |
122 |
Q |
| |
|
||||||||||||| ||| |||| || |||||||||||||||| |||||||||||| ||||||||| ||||||| ||||| ||||||| |
|
|
| T |
7437839 |
tagctctaacttcaaggatgagggagtagagtggctcacaca-ccccacgaaatacaaaccaatcaatccaaagcgcatgcaccaagg |
7437753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 181
Target Start/End: Complemental strand, 6657888 - 6657855
Alignment:
| Q |
148 |
tttgaaaattttcttataaataggaccgaagaga |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6657888 |
tttgaaaattttcttataaataggaccgaagaga |
6657855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 146 - 175
Target Start/End: Complemental strand, 4641058 - 4641029
Alignment:
| Q |
146 |
tttttgaaaattttcttataaataggaccg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4641058 |
tttttgaaaattttcttataaataggaccg |
4641029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University