View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_low_35 (Length: 227)
Name: NF14332_low_35
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 26 - 202
Target Start/End: Complemental strand, 1814744 - 1814568
Alignment:
| Q |
26 |
agttatatattcttggactaacattcacaatggatcatgtgaatcaatcattaagattgcatatgtttaaagagctgtgtaatggtagatgcaatataca |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1814744 |
agttatatattcttggactaacattcacaatggatcatgtgaatcaatcattaagattgcatatgtttaaagagctgtgtaatggtagatgcaatataca |
1814645 |
T |
 |
| Q |
126 |
tttagaaaatttgaagatatagaaatcactaaccatgagcgtcaaacgataatcattcacttgctttcatagttgaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1814644 |
tttagaaaatttgaagatatagaaatcactaaccagtagcgtcaaacgataatcactcacttgctttcatagttgaa |
1814568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 32 - 211
Target Start/End: Complemental strand, 1830374 - 1830208
Alignment:
| Q |
32 |
atattcttggactaacattcacaatggatcatgtgaatcaatcattaagattgcatatgtttaaagagctgtgtaatggtagatgcaatatacatttaga |
131 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||| |||| | ||| ||||| ||| | ||| | | |||||||||| |
|
|
| T |
1830374 |
atattcttggactaacattcacaaaggatcatgtgaatgaatcattaaaattgaa-----tta------tgtgt--tggcaaatggactgtacatttaga |
1830288 |
T |
 |
| Q |
132 |
aaatttgaagatatagaaatcactaaccatgagcgtcaaacgataatcattcacttgctttcatagttgaacgcatcact |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||| ||||||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
1830287 |
aaatttgaagatatagaaatcactaaccagtagcggcaaactataatcactcacttgctttcatagttgaatgcaccact |
1830208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University