View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14332_low_38 (Length: 215)
Name: NF14332_low_38
Description: NF14332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14332_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 28818462 - 28818644
Alignment:
| Q |
18 |
gatattgcacccttcttaaaacaaggtaaaattagaatgctttctttatttggattttagatgaagagtgaataggaaaattggttctcgaaattgtatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28818462 |
gatattgcacccttcttaaaacaaggtaaaattagaatgctttctttatttggattttagatgaagagtgaataggaaaattggttctcgaaattgtatg |
28818561 |
T |
 |
| Q |
118 |
catcggccaaatagtttatgatctttccaaattggcaaatatatccttggaattgtaaaatgtcattttaagtaatccctttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28818562 |
catcggccaaatagtttatgatctttccaaattggcaaatatacccttggaattgtaaaatgtcattttaagtgatccctttg |
28818644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University