View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14334_high_23 (Length: 257)
Name: NF14334_high_23
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14334_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 52815256 - 52815020
Alignment:
| Q |
1 |
aatttaacccaaattaggggaagaaaaaatctttgtagctacgtcaggttcatgcaatagtgcaacgcataaacgacatacgaaaaatccaataacaagc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52815256 |
aatttaacctaaattaggggaagaaaaaatctttgtaggtacgtcaggctcatgcagtagtgcaacgcataaacgacatatgaaaaatccaataacaagc |
52815157 |
T |
 |
| Q |
101 |
tactgaggtggtttcttttcttcaaagtaatttaatatcttatgatgctacatttaatttatcaattatagattcttttttgttgttgtgcactgcaaac |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
52815156 |
tactgaggtggtttcttttcctcaaagtaatttaatatcttatgatactacatttaatttatcaattatagattcttttttgttgctg-----tgcaaac |
52815062 |
T |
 |
| Q |
201 |
tcacataattatgaaaatatcgtttgacatgactatggaaga |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52815061 |
tcacataattatgaaaatatcgtttgacatgactatggaaga |
52815020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 52 - 101
Target Start/End: Complemental strand, 22079694 - 22079645
Alignment:
| Q |
52 |
atgcaatagtgcaacgcataaacgacatacgaaaaatccaataacaagct |
101 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| || ||||||| |||||| |
|
|
| T |
22079694 |
atgcaatagtgcaacgcataagcgacaaacgagaagtccaatagcaagct |
22079645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University