View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14334_low_20 (Length: 294)

Name: NF14334_low_20
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14334_low_20
NF14334_low_20
[»] chr6 (4 HSPs)
chr6 (10-107)||(32671095-32671190)
chr6 (175-228)||(32672244-32672297)
chr6 (105-161)||(32672164-32672219)
chr6 (105-149)||(32670976-32671020)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 6e-37; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 10 - 107
Target Start/End: Complemental strand, 32671190 - 32671095
Alignment:
10 gcagagagttattatgcatgctttagcatatattatgtgagaaatattgtttgcatggaaaaggaaacaaacacatccaaacaagcacgcctaagaaa 107  Q
    ||||||||||||||||||||  |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32671190 gcagagagttattatgcatggcttagcatat--tatgtgagaaatattgtttgcatggaaaaggaaacaaacacatccaaacaagcacgcctaagaaa 32671095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 175 - 228
Target Start/End: Original strand, 32672244 - 32672297
Alignment:
175 ctcatgtaaggggatggaatgataatgaactatttattgtcaaaagtattaaga 228  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
32672244 ctcatgtaaggggatggaatgatcatgaactatttattgtcaaaagtattaaga 32672297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 105 - 161
Target Start/End: Original strand, 32672164 - 32672219
Alignment:
105 aaacatagatgatcaatattttagttactcttcacaactcatgtaaggggatttact 161  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
32672164 aaacatagatgatcaatattt-agttactcttcacaactcatgtaaggggatttact 32672219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 105 - 149
Target Start/End: Complemental strand, 32671020 - 32670976
Alignment:
105 aaacatagatgatcaatattttagttactcttcacaactcatgta 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
32671020 aaacatagatgatcaatattttagttactcttcacaactcatgta 32670976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University