View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14334_low_22 (Length: 277)
Name: NF14334_low_22
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14334_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 9699935 - 9699671
Alignment:
| Q |
1 |
tatgataagcacttatggtataaaagtttcattaagttgtttatccaaacatgacttaaatttgttgagtcatcagtcatcctgaaagaaaacaatttac |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699935 |
tatgatacgcacttatggtataaaagtttcattaagttgtttatccaaacatgacttaaatttgttgagtcatcagtcatcctgaaagaaaacaatttac |
9699836 |
T |
 |
| Q |
101 |
tcaaccattacctgaacgtatattgataagaagtacatcagggtgataagtaggcaaagatccaccgatcagatcagctacttctaagatgctccacaaa |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699835 |
tcaaccattacctgaacttatattgataagaagtacatcagggtgataagtaggcaaagatccaccgatcagatcagctacttctaagatgctccacaaa |
9699736 |
T |
 |
| Q |
201 |
ccaaccttggtaaggagttcagattttaattgttccttggcaagaatcacgctgctgcacaggtt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9699735 |
ccaaccttggtaaggagttcagattttaattgttccttggcaagaatcacgctgctgtacaggtt |
9699671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 31875698 - 31875748
Alignment:
| Q |
1 |
tatgataagcacttatggtataaaagtttcattaagttgtttatccaaaca |
51 |
Q |
| |
|
|||||||||| |||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
31875698 |
tatgataagcgcttatgctataaacgcttcattaagttgtctatccaaaca |
31875748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 2519633 - 2519571
Alignment:
| Q |
1 |
tatgataagcacttatggtataaaagtttcattaagttgtttatccaaacatgacttaaattt |
63 |
Q |
| |
|
||||||||||||||||| |||||| | || |||||||||||||||||||||| ||||| |||| |
|
|
| T |
2519633 |
tatgataagcacttatgttataaacgcttgattaagttgtttatccaaacataacttacattt |
2519571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 45201123 - 45201156
Alignment:
| Q |
33 |
taagttgtttatccaaacatgacttaaatttgtt |
66 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
45201123 |
taagttgtttatccaaacatgccttaaatttgtt |
45201156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34922887 - 34922839
Alignment:
| Q |
1 |
tatgataagcacttatggtataaaagtttcattaagttgtttatccaaa |
49 |
Q |
| |
|
||||| ||||||||||| ||||| || || ||||||||||||||||||| |
|
|
| T |
34922887 |
tatgacaagcacttatgctataagaggttaattaagttgtttatccaaa |
34922839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 942215 - 942259
Alignment:
| Q |
1 |
tatgataagcacttatggtataaaagtttcattaagttgtttatc |
45 |
Q |
| |
|
|||||||| || ||||| |||||| |||||||||||||||||||| |
|
|
| T |
942215 |
tatgataaacatttatgctataaacgtttcattaagttgtttatc |
942259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 5923421 - 5923369
Alignment:
| Q |
1 |
tatgataagcacttatggtataaaagtttcattaagttgtttatccaaacatg |
53 |
Q |
| |
|
|||||||||| |||||| ||||| || | ||||||||||||||||||||||| |
|
|
| T |
5923421 |
tatgataagcccttatgctataagcgtataattaagttgtttatccaaacatg |
5923369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University