View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14334_low_25 (Length: 259)
Name: NF14334_low_25
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14334_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 8 - 240
Target Start/End: Original strand, 9263882 - 9264117
Alignment:
| Q |
8 |
caacacagaggtagatcacaaaactcccctttttcacaacagtggaaacgctgtgcattgccaattaagccacctacagtaacatgaaacaaatcaatca |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9263882 |
caacacggaggtagatcacaaaactcccctttttcacaacagtggaaacgctgtgcattgccaattaagccacctgcagtaacatgaaacaaatcaatca |
9263981 |
T |
 |
| Q |
108 |
caattagatatacaag---nnnnnnnnnnnnnaatttatagttttatttatgaaaaacaatatccacaatagatatttatcaaatcggtttatcaatttt |
204 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9263982 |
caatttgatatacaagttaatttattttttttaatttatagttttatttatgaaaaacaatatccacaatagatatttatcaaatcggtttatcaatttt |
9264081 |
T |
 |
| Q |
205 |
aacatttttcttttcctcaactgcaagatcgatagc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9264082 |
aacatttttcttttcctcaactgcaagatcgatagc |
9264117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University