View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14334_low_30 (Length: 246)
Name: NF14334_low_30
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14334_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 12037851 - 12037687
Alignment:
| Q |
64 |
ccaacagctacatgctcagtacttttctcaaaatcttcacatgcagactttcttttctcagtagtattactaataactgctgctgcttcttcttctccta |
163 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12037851 |
ccaacagctacatgcttggtatttttctcaaagtcttcacatgcagactttcttttctcagtagtattactaataactgctgct---tcttcttctccta |
12037755 |
T |
 |
| Q |
164 |
gcttcatctcttgctcgatcaggcgtttgagttcctcggtgattttcttaacatgacgagtgcctttg |
231 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
12037754 |
gcttcgtctcttgctcgatcaggcgtttgagtttctcggtggttttcttaacatgacgagtgcctttg |
12037687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 63 - 142
Target Start/End: Complemental strand, 11859054 - 11858975
Alignment:
| Q |
63 |
gccaacagctacatgctcagtacttttctcaaaatcttcacatgcagactttcttttctcagtagtattactaataactg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
11859054 |
gccaacagctacatgctcagtacttttctcaaaatctttgtatgccaactttcttttctcattagtattactaataactg |
11858975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University