View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14334_low_32 (Length: 226)
Name: NF14334_low_32
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14334_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 41298333 - 41298145
Alignment:
| Q |
20 |
agggattggccatgggaacaagtgagagttgagactcggcagtaactacagcagctttaccagtgccttcctcaagtgttgtgttgtcttttttcttctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41298333 |
agggattggccatgggaacaagtgagagttgagactcggcagtaactacagcagctttaccagtgccttcctcaagtgttgtgttgtcttttttcttctt |
41298234 |
T |
 |
| Q |
120 |
ggcttgcagctcatgccaccattctggatacccatgtaacttgaaacatgtatcacgagtgtgtttgacatttccacaatgagtgcact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
41298233 |
ggcttgcagctcatgccaccattctggatacccatgtaacttgaaacatgtatcacgagtgtgtctgacatttccacaatgagttcact |
41298145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 182
Target Start/End: Original strand, 15668848 - 15668901
Alignment:
| Q |
129 |
ctcatgccaccattctggatacccatgtaacttgaaacatgtatcacgagtgtg |
182 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| ||||| ||||| ||||| |
|
|
| T |
15668848 |
ctcattccaccattctggatacccatgcaacttgaagcatgtgtcacgggtgtg |
15668901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 182
Target Start/End: Original strand, 5864281 - 5864334
Alignment:
| Q |
129 |
ctcatgccaccattctggatacccatgtaacttgaaacatgtatcacgagtgtg |
182 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| ||||| ||||| ||||| |
|
|
| T |
5864281 |
ctcattccaccattctggatacccatgcaacttgaagcatgtgtcacgggtgtg |
5864334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 182
Target Start/End: Original strand, 34171265 - 34171318
Alignment:
| Q |
129 |
ctcatgccaccattctggatacccatgtaacttgaaacatgtatcacgagtgtg |
182 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| ||||| ||||| ||||| |
|
|
| T |
34171265 |
ctcattccaccattctggatacccatgcaacttgaagcatgtgtcacgggtgtg |
34171318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 526026 - 526097
Alignment:
| Q |
135 |
ccaccattctggatacccatgtaacttgaaacatgtatcacgagtgtgtttgacatttccacaatgagtgca |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||| | || || || | ||||||||||||||||| |
|
|
| T |
526026 |
ccaccattctgggtacccatgtaacttgaaacaagtttcatgtgtatgcttcaactttccacaatgagtgca |
526097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University