View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14334_low_35 (Length: 207)
Name: NF14334_low_35
Description: NF14334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14334_low_35 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 5 - 207
Target Start/End: Original strand, 420429 - 420629
Alignment:
| Q |
5 |
attgcctaaaacatattactttagacccaataggaagnnnnnnnnncaatcatggggtgctaaaaagttcaaactttttaattactccaatagagtgctt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
420429 |
attgcctaaaacatattactttagacccaataggaa--aaaaaaaacaatcatggggtgctaaaaagttcaaactttttaattactccaatagagtgctt |
420526 |
T |
 |
| Q |
105 |
agttgagtatgttttaaactcaatttctctaaccatgttattgtggaaaattttgttatgtactcttgataattgaggttttcgacagggttaacaaata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
420527 |
agttgagtatgttttaaactcaatttctctaatcatgttattgtggaaaattttgttatgtactcttgataattgaggttttcgacagtgttaacaaata |
420626 |
T |
 |
| Q |
205 |
aca |
207 |
Q |
| |
|
||| |
|
|
| T |
420627 |
aca |
420629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University