View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14335_high_25 (Length: 242)
Name: NF14335_high_25
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14335_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 41788269 - 41788480
Alignment:
| Q |
13 |
attatacttcacataaccctttgctggtggtttccaattcgtatccgtaacaatctgctgtacagcaggagttgccttgttgactcgaacagcagatagc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41788269 |
attacacttcacataaccctttgctggtggtttccaattcgtatccgtaacaatctgttgtacagcaggagttgccttgttgactcgaacag---atagc |
41788365 |
T |
|
| Q |
113 |
cattcccttaacgtgtcccgcactagctgaatggatatgtgtggctccttcacctcttcatgccacaccttttcgttacgtctccgccatagacaccaca |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41788366 |
cattcccttaacgtgtcccgcgctagctgaatggatatgtgtggctccttcacctcgtcatgccacaccttttcgttacatctccgccatagacaccaca |
41788465 |
T |
|
| Q |
213 |
tgatcatgatgatat |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41788466 |
tgatcatgatgatat |
41788480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 228
Target Start/End: Complemental strand, 28481154 - 28481072
Alignment:
| Q |
146 |
gatatgtgtggctccttcacctcttcatgccacaccttttcgttacgtctccgccatagacaccacatgatcatgatgatatt |
228 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
28481154 |
gatatatgtggctccttcgcctcgtcatgccacaccttttcgttacgtctccgccatagacattacaggatcatgatgatatt |
28481072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University