View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14335_high_26 (Length: 240)

Name: NF14335_high_26
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14335_high_26
NF14335_high_26
[»] chr4 (1 HSPs)
chr4 (1-224)||(2783240-2783463)


Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 2783463 - 2783240
Alignment:
1 agcgatcgtaactaaccgtccgtcaatcccggagagattgttagggcggttatggcgaagggaggacaatgcttgttggagaagctttggaggtgtattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2783463 agcgatcgtaactaaccgtccgtcaatcccggagagattgttagggcggttatggcgaagggaggacaatgcttgttggagaagctttggaggtgtattc 2783364  T
101 gaacggttttctttgttgttgcattggtggtttcgcttattgttacgtcgcttccggtggttgttgcggtggttgatgttcttgttccgtgtgttttgat 200  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2783363 gaacggttttctttgttgttgcattggtggtttcgctgattgttacgtcgcttccggtggttgttgcggtggttgatgttcttgttccgtgtgttttgat 2783264  T
201 ctccaattttacttgtgttaattg 224  Q
    ||||||||||||||||||||||||    
2783263 ctccaattttacttgtgttaattg 2783240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University