View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14335_high_27 (Length: 235)
Name: NF14335_high_27
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14335_high_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 217
Target Start/End: Original strand, 38532868 - 38533073
Alignment:
| Q |
12 |
agagatgaagatcagtttcgatgtcttaaaaacctacgatcgaccatgcaactttcttgtcttcggacttggccatgattctctcatgtgggcttcgttt |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532868 |
agagatcaagatcagtttcgatgtcttaaaaacctacgatcgaccatgcaactttcttgtcttcggacttggccatgattctctcatgtgggcttcgttt |
38532967 |
T |
|
| Q |
112 |
aacccaggtggcaacacattattccttgaagaagatcctaaatgggttcaaaccgttcttaaagatgcaccgggccttcgagcccataccgttcgttatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532968 |
aacccaggtggcaacacattattccttgaagaagatcctaaatgggttcaaaccgttcttaaagatgcaccgggccttcgagcccataccgttcgttatc |
38533067 |
T |
|
| Q |
212 |
gaaccc |
217 |
Q |
| |
|
|||||| |
|
|
| T |
38533068 |
gaaccc |
38533073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 184
Target Start/End: Complemental strand, 34715467 - 34715422
Alignment:
| Q |
139 |
gaagaagatcctaaatgggttcaaaccgttcttaaagatgcaccgg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
34715467 |
gaagaagatcctaaatgggttcaaaccgttctcaaagacgcaccgg |
34715422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 55 - 152
Target Start/End: Original strand, 10188847 - 10188944
Alignment:
| Q |
55 |
ccatgcaactttcttgtcttcggacttggccatgattctctcatgtgggcttcgtttaacccaggtggcaacacattattccttgaagaagatcctaa |
152 |
Q |
| |
|
|||||||||||||| || || ||| |||| || || | |||||||||| ||||||||| ||| |||||| |||| ||| || |||||||||||||| |
|
|
| T |
10188847 |
ccatgcaactttctcgtgtttggaattggtcacgacgcactcatgtgggattcgtttaatccacgtggcatcacactatatctcgaagaagatcctaa |
10188944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University