View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14335_low_24 (Length: 387)
Name: NF14335_low_24
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14335_low_24 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 6491 - 6721
Alignment:
| Q |
17 |
gaatgatagaaacatgtacaaaagatattcagaaaaactagatagggacaatatcggcatatcaattatcttgacaaaggttaaagctatacacactgaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6491 |
gaatgatagaaacatgtacaaaagatattcagaaaaactagatagggacaatatcggcatatcaattatcttgacaaaggttaaagccatacacactgaa |
6590 |
T |
 |
| Q |
117 |
tcaataaatcacataattacccatattagaattagaaaaggcctccattaaactcaaatgtattatgtttgtatcatctctgaaattgtctccaataaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6591 |
tcaataaatcacataattacccatattagaattagaaaaggcctccattaaactcaaatgtattatgtttgtatcatctctgaaattgtctccaataaga |
6690 |
T |
 |
| Q |
217 |
atgtggtcaaacatttttaatttcagatgtt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6691 |
atgtggtcaaacatttttaatttcagatgtt |
6721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 247 - 369
Target Start/End: Original strand, 6783 - 6906
Alignment:
| Q |
247 |
ttgtgattcatactgtatacaacctactaaaagaaggctttgtatgtattcttcaaaagaaaaatcatccctgcatctatgtggtgttcattgcctttaa |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6783 |
ttgtgattcatactgtatacaacctactaaaagaaggctttgtatgtattcttcaaaagaaaaatcatccctgcatctatgtggtgttcattgcctttaa |
6882 |
T |
 |
| Q |
347 |
gttag-ggtggtaggccgcctaat |
369 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
6883 |
gttagcggtggtaggccgcctaat |
6906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University