View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14335_low_28 (Length: 349)
Name: NF14335_low_28
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14335_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 2 - 188
Target Start/End: Original strand, 4319009 - 4319195
Alignment:
| Q |
2 |
actaggagaatctgttttcacttatgattaattttatcatttgtactactatatatgagtttgtttagatcgaccttctgaatttttctattgctacaaa |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4319009 |
actaagagaatctgttttcacttatgattaattttatcatttgtactactatatatgagtttgtttagatcgaccttctgaatttttctattgctacaaa |
4319108 |
T |
 |
| Q |
102 |
catttgtaaaactgtttaagagaatttaaaaagtttacgatatgttcaagatagttttcgaaaacaactaatccatgcacattttgt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4319109 |
catttgtaaaactgtttaagagaatttaaaaagtttacgatatgttcaagatagttttcgaaaacaactaatccatgcacattttgt |
4319195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 245 - 336
Target Start/End: Original strand, 4319261 - 4319351
Alignment:
| Q |
245 |
caatttgattttgttttaccttttgttatagaactattannnnnnnnataaattttatatcaatagcgcttatgatataatcacttaagtga |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4319261 |
caatttgattttgttttaccttttgttatagaactattattttttt-ataaattttatatcaaaagcgcttatgatataatcacttaagtga |
4319351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University