View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14335_low_29 (Length: 342)
Name: NF14335_low_29
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14335_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 55 - 331
Target Start/End: Complemental strand, 37162302 - 37162029
Alignment:
| Q |
55 |
ctattcattttgtaaggttttttagattcttctacttggctcattttttaccctctcattgcatgtttgaattttatttggtaagagacaaggatgattt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37162302 |
ctattcattttgtaaggttttttagattct---acttggctcattttttaccctctcattgcatgtttgaattttattttgtaagagacaaggatgattt |
37162206 |
T |
|
| Q |
155 |
tagaaaacattgaattgatattgcttttttgggaagtgctcgagtaaaatagttttcatctcagctggagaaaaatggttttcatctacatactaacaaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37162205 |
tagaaaacattgaattgatattgcttttttgggaagtgctcgagtaaattagttttcatctctgctggagaaaattggttttcatctacatactaacaaa |
37162106 |
T |
|
| Q |
255 |
tacttttaacttgaagctgatatttaaaaattgttccaagaatcaatttttaacaacaaatttattgtttgattcat |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37162105 |
tacttttaacttgaagctgatatttaaaaattgttccaagaatcaatttttaacatcaaatttattgtttgattcat |
37162029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University