View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14335_low_30 (Length: 336)
Name: NF14335_low_30
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14335_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 34768233 - 34768554
Alignment:
| Q |
1 |
caatcatctccggttggaaacaaagtcagaacctttctccctccagatgcattagctgattccatatcctccacataacca---ccaccaccacctaaag |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34768233 |
caatcatctccggttggaaacaaagtcagaacctttctccctccagatgcattagctgattccatatcctccacataaccaccaccaccaccacctaaag |
34768332 |
T |
|
| Q |
98 |
tgttatgatgcacctgtgccccaattctatgaagctgctgctggtgttgatgctgattttgctgttgatgatgttgctgtctagacaaaaaaggattatc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34768333 |
tgttatgatgcacctgtgccccaattctatgaagctgctgctggtgttgatgctggttttgctgttgatgatgttgctgtctagacaaaaaaggattatc |
34768432 |
T |
|
| Q |
198 |
aaaatgcccatttggcggcgacccgaaatgtccaaccggccgatgatactgagcagcagccatctgctgctgatgatgaatagcaggaacaggaacaaac |
297 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34768433 |
aaaatgtccatttggcggcgacccgaaatgtccaaccggccgatgatactgagcagcagccatctgctgctgatgatgaatagcaggaacaggaacaaac |
34768532 |
T |
|
| Q |
298 |
ggcataaaatgatcggaattcg |
319 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34768533 |
ggcataaaatgatcggaattcg |
34768554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University