View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14335_low_36 (Length: 259)
Name: NF14335_low_36
Description: NF14335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14335_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 99 - 247
Target Start/End: Complemental strand, 34749268 - 34749126
Alignment:
| Q |
99 |
gtccacaacaattaatgtaattgtactatgtctatatagttgcttgaggttgttccccaatttttgtttacatcaatccatcaatcaaagtcattgcaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749268 |
gtccacaacaattaatgtaattgtactatgtctatatagttgcttgaggttgttcccc-atttatgtttacatcaatccatcaatcaaagtcattgcaac |
34749170 |
T |
|
| Q |
199 |
tttgcagggtttggtacccaaccctatgcttaacaaaatttaacagaat |
247 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34749169 |
tttgcagggtttggt-----accctatgcttaacaaaatttaacagaat |
34749126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University