View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_high_29 (Length: 345)
Name: NF14336_high_29
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 11 - 329
Target Start/End: Complemental strand, 22101864 - 22101546
Alignment:
| Q |
11 |
cacagatatgaaaccccacacctacagctcattgcgcagcaacgaaacaataagcttccacatgccatttgtagccctgtagccaatcccacggaatgac |
110 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
22101864 |
cacagatacgaaaccccacacctacagctcattgcgcagcaacgaaacaataagcctccacatgccatttatagccctatagccaatcacacggaatgac |
22101765 |
T |
 |
| Q |
111 |
tcagaggaaacaagctccaaacacacgtagaacccagatcgagggatgatttcaacagtacaccctcgagtaacaacagtccaaacgaaacatactcttg |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||| ||||||| |
|
|
| T |
22101764 |
tcagaggaaacaagctccaaacacgcgtagaacccagatcgagggatgatttcaacagtacaccctcaagtcacaacagcccaaacgaaacggactcttg |
22101665 |
T |
 |
| Q |
211 |
catgtgttttgagaccgaaccggagccattccaaaaactcgagtgtggcagacgcaaatctaaaactttgaaacctgcggttctcaacagatatagacca |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22101664 |
catgtgttttgagaccgaaccggagccattccaaaaactcgaatgtggatgacacaaatctaaaacttcgaaacctgcggttctcaacagatatagacca |
22101565 |
T |
 |
| Q |
311 |
atgcaggaaaccaaaggac |
329 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
22101564 |
atccaggaaaccaaaggac |
22101546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University