View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_high_49 (Length: 238)
Name: NF14336_high_49
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_high_49 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 199 - 238
Target Start/End: Complemental strand, 4532321 - 4532282
Alignment:
| Q |
199 |
aagcttttgccttcttctccatcatatgtgacctctttct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4532321 |
aagcttttgccttcttctccatcatatgtgacctctttct |
4532282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University