View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14336_high_49 (Length: 238)

Name: NF14336_high_49
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14336_high_49
NF14336_high_49
[»] chr2 (1 HSPs)
chr2 (199-238)||(4532282-4532321)


Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 199 - 238
Target Start/End: Complemental strand, 4532321 - 4532282
Alignment:
199 aagcttttgccttcttctccatcatatgtgacctctttct 238  Q
    ||||||||||||||||||||||||||||||||||||||||    
4532321 aagcttttgccttcttctccatcatatgtgacctctttct 4532282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University