View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14336_high_54 (Length: 222)

Name: NF14336_high_54
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14336_high_54
NF14336_high_54
[»] chr6 (1 HSPs)
chr6 (18-205)||(32574960-32575146)


Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 32574960 - 32575146
Alignment:
18 caggaacgaacgaacaggtgagtaacgaatttgcgaactctattttcatattctgattttgaatttcacgcatcggtttggttctatgcgaattgagata 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32574960 caggaacgaacgaacaggtgagtaacgaatttgcgaactctattttcatattctgattttgaatttcacgcatcggtttggttctatgcgaattgagata 32575059  T
118 acgtttggatttagaaatgatatggattgtgaattttggggatatgattggggaaggtgaatttcggcaagttatgaggtttatggat 205  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
32575060 acgtttggatttagaaatgatatggattgtgaatttt-gggatatgattggggaaggtgaatttcggcaagttatgaggtttatggat 32575146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University