View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_26 (Length: 378)
Name: NF14336_low_26
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 190 - 368
Target Start/End: Complemental strand, 49758110 - 49757932
Alignment:
| Q |
190 |
ccacagctgtactgacctatgctgcagctgcacctttgtccccatcaccaaataatctttgcttgaaatcagcgaccattagaggaagtccctcacggag |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49758110 |
ccacagctgtactgacctatgctgcagctgcacctttgtccccatcaccaaataatctttgcttgaaatcagcgaccattagaggaagtccctcacggag |
49758011 |
T |
|
| Q |
290 |
ggacacagatggttgccagccaagaagctcttttgctttggagatgtctggctttctcttatgtggatcatcctctgtg |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49758010 |
ggacacagatggttgccagccaagaagctcttttgctttggagatgtctggctttctcttatgtggatcatcctctgtg |
49757932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 19 - 126
Target Start/End: Complemental strand, 49758281 - 49758174
Alignment:
| Q |
19 |
aaaaattgcatcttcttcccttgaccggcgagtgctgcttattttgctgccagacgtatataaatctcatctgatatatatatctaatttgattcaaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49758281 |
aaaaattgcatcttcttcccttgaccggcgagtgctgcttattttgctgccagacgtatataaatctcatctgatatatatatctaatttgatccaaaac |
49758182 |
T |
|
| Q |
119 |
aagtcaag |
126 |
Q |
| |
|
|||||||| |
|
|
| T |
49758181 |
aagtcaag |
49758174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University