View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_27 (Length: 378)
Name: NF14336_low_27
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 15 - 352
Target Start/End: Complemental strand, 24663383 - 24663046
Alignment:
| Q |
15 |
cacagaaaccaaacaattctccatagtagagaagtctccaggttccttctctcttcttaatgctttctcttcactgtaatcatcatcttttccatcaaat |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24663383 |
cacagaaatcaaacaattctccatagtagagaagtctccaggttccttctctcttcttaatgctttctcttcactgtaatcatgatcttttccatcaaat |
24663284 |
T |
|
| Q |
115 |
tcttgatcattgagcaatgaaggatcaattatatctatggcatgatttggtaaagccaaggctgtaaactgttggattcccatgccaccttcaaacattt |
214 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24663283 |
tcttgatcatagagcaatgaaggatcaattatatctatggcatgatttggtaaagccaaggctgtaaactgttggattcccatgccaccttcaaacattt |
24663184 |
T |
|
| Q |
215 |
catttgttggtctttttcctgtgaaaatctctagcaatagtatcccataactgtaaacatctcctagtgcagaagggtgtccacccattccatactctgc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24663183 |
catttgttggtctttttcctgtgaaaatctctagcaatagtatcccataactgtaaacatctcctagtgcagaagggtgtccacccattccatactctgc |
24663084 |
T |
|
| Q |
315 |
ataatttgtaacacaaatattgttagtgtattaaaaag |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24663083 |
ataatttgtaacacaaatattgttagtgtattaaaaag |
24663046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University