View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_46 (Length: 250)
Name: NF14336_low_46
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 13 - 164
Target Start/End: Original strand, 3433107 - 3433258
Alignment:
| Q |
13 |
aatatatcaatgattattaagtatttaaccgcaaaactcacacacactaaataagaaatggaaaattgtgggctcaaacttacacctcactatgttcaat |
112 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3433107 |
aatatatcaatgattattaagtgtttagccgcaaaactcacgcacactaaataagaaatggaaaattgtgggctcaaacttacacctcactatgggcaat |
3433206 |
T |
|
| Q |
113 |
gtttttgcaacttattaccttcaaaggagtagttcttatgaaactatatatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3433207 |
gtttttgcaacttattaccttcaaaggagtagttcttatgaaactatatatt |
3433258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 250
Target Start/End: Original strand, 3433296 - 3433344
Alignment:
| Q |
202 |
cctcttcttagttacgaggttataccaaatattcttaccgcattttaac |
250 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
3433296 |
cctcttcttaattacgaggttataccaaatgttcttaccgcattgtaac |
3433344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University