View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_52 (Length: 225)
Name: NF14336_low_52
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 19 - 126
Target Start/End: Complemental strand, 49758281 - 49758174
Alignment:
| Q |
19 |
aaaaattgcatcttcttcccttgaccggcgagtgctgcttattttgctgccagacgtatataaatctcatctgatatatatatctaatttgattcaaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49758281 |
aaaaattgcatcttcttcccttgaccggcgagtgctgcttattttgctgccagacgtatataaatctcatctgatatatatatctaatttgatccaaaac |
49758182 |
T |
 |
| Q |
119 |
aagtcaag |
126 |
Q |
| |
|
|||||||| |
|
|
| T |
49758181 |
aagtcaag |
49758174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University