View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_54 (Length: 224)
Name: NF14336_low_54
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 50635447 - 50635254
Alignment:
| Q |
17 |
atatttaggacccgtttgataaaaataattttatggagaaactactcaaaatactttcttatttgaaggatcttcttgannnnnnnnnncttcaaaatga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50635447 |
atatttaggacccgtttgataaaaataattttatggagaaactactcaaaatactttcttatttgaaggatcttcttgattttttttttcttcaaaatga |
50635348 |
T |
|
| Q |
117 |
tagcaaaattgacttttaaaagtgattattttgattatttcgtgtaaaaaattggaacaaacattctattattaatcttgggtttattgattgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50635347 |
tagcaaaattgacttttaaaagtgattattttgattatttcgtgtaaaaaattggaacaaacattttattattaatcttgggtttattgattgt |
50635254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University