View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_57 (Length: 215)
Name: NF14336_low_57
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 1059196 - 1059399
Alignment:
| Q |
1 |
gcttagtctgataatgctttggagtttggagccagctcacacattttgtaaatggtcaggaaaacatagtatgtaagagtaaaactacttttgtatgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1059196 |
gcttagtctgataatgctttggagtttggagccagctcacacattttgtaaatggtcaggaaaacatagtatgtaagagtaaaactacttttgtatgtga |
1059295 |
T |
|
| Q |
101 |
taaagtcactgtatgccaaaaagaagtttacctgattttacaaaattacaatacgcgttttgtgctaacaagaggattatttccgttgtctcgcctttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
1059296 |
taaagtcactgtatgccaaaaagaagtttacctgattttacaaaattacaatacgcgttttgtgctaacaagaggattatttccattgtctcgtctttgt |
1059395 |
T |
|
| Q |
201 |
ttct |
204 |
Q |
| |
|
|||| |
|
|
| T |
1059396 |
ttct |
1059399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 25 - 127
Target Start/End: Original strand, 1072076 - 1072179
Alignment:
| Q |
25 |
tttggagccagctcacacattttgtaaatggtcaggaaaacatagtatgtaagagtaaaactacttttg--tatgtgataaagtcactgtatgccaaaaa |
122 |
Q |
| |
|
|||||| |||| ||||||||||||||||| |||||| || ||||||||||||||||||||||||| ||| |||||||| ||||||||| ||||||| || |
|
|
| T |
1072076 |
tttggacccagttcacacattttgtaaattgtcagggaa-catagtatgtaagagtaaaactactgttgtatatgtgattaagtcactgaatgccaacaa |
1072174 |
T |
|
| Q |
123 |
gaagt |
127 |
Q |
| |
|
||||| |
|
|
| T |
1072175 |
gaagt |
1072179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University