View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_58 (Length: 213)
Name: NF14336_low_58
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 137 - 196
Target Start/End: Original strand, 27704708 - 27704767
Alignment:
| Q |
137 |
tatctcccccatatttttaactattttgttattccttatcatcatttgcttcttcaatat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27704708 |
tatctcccccatatttttaactattttgttattggttatcatcatttgcttcttcaatat |
27704767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 27703929 - 27703994
Alignment:
| Q |
20 |
attgacaatctagtatgctaaatgtagaagtatcttaataaacccaattttgtaatgttgtatatt |
85 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||||| | |||||||| ||||||||||| |
|
|
| T |
27703929 |
attgacaatctagtatcctaaatgtagaagtctctaaataaattcgattttgtagtgttgtatatt |
27703994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 117
Target Start/End: Original strand, 27704670 - 27704710
Alignment:
| Q |
77 |
ttgtatattaagatgcaagcaaatagagtagtttatagtat |
117 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
27704670 |
ttgtatattaaggtgcaagtaaatagagtagtttatagtat |
27704710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University