View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14336_low_59 (Length: 213)
Name: NF14336_low_59
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14336_low_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 19781074 - 19780895
Alignment:
| Q |
16 |
cagagacaggtttctatgctggtggttcagatgggtttgtttataaagggttaatgaaagttgggaatagaaaaatgttggaaaaaggaaaagcttatga |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
19781074 |
cagagtcaggtttctatgctggtggttcagatgggtttgtttataaagggttaatgaaagttgggaatagaaaaatgttagaaaaaggaaaagcgtatga |
19780975 |
T |
 |
| Q |
116 |
attggttaatttgggtaacaaaacaaaaagccatgatgggtcaattatgtctttggttttggtgaatgaagggaggaatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19780974 |
attggttaatttgggtaacaaaacaaaaagccatgatgggtcaattatgtctttggttttggtgaatgaagggaggaatt |
19780895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University