View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14336_low_59 (Length: 213)

Name: NF14336_low_59
Description: NF14336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14336_low_59
NF14336_low_59
[»] chr8 (1 HSPs)
chr8 (16-195)||(19780895-19781074)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 19781074 - 19780895
Alignment:
16 cagagacaggtttctatgctggtggttcagatgggtttgtttataaagggttaatgaaagttgggaatagaaaaatgttggaaaaaggaaaagcttatga 115  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||    
19781074 cagagtcaggtttctatgctggtggttcagatgggtttgtttataaagggttaatgaaagttgggaatagaaaaatgttagaaaaaggaaaagcgtatga 19780975  T
116 attggttaatttgggtaacaaaacaaaaagccatgatgggtcaattatgtctttggttttggtgaatgaagggaggaatt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19780974 attggttaatttgggtaacaaaacaaaaagccatgatgggtcaattatgtctttggttttggtgaatgaagggaggaatt 19780895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University