View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14337_high_17 (Length: 331)
Name: NF14337_high_17
Description: NF14337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14337_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 65 - 175
Target Start/End: Original strand, 19974190 - 19974300
Alignment:
| Q |
65 |
atagtagcaatctatgatagttcccgaagtagcaattcctatttttgtttctaaacagtttgtaaataagggacttttctttctttcttttaaaaggaaa |
164 |
Q |
| |
|
|||||||| | |||||||||||||| |||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19974190 |
atagtagctagctatgatagttcccaaagtggcaattcctatttttgtttctaaaaagtgtgtaaataagggacttttctttctttcttttaaaaggaaa |
19974289 |
T |
|
| Q |
165 |
aggcataaggt |
175 |
Q |
| |
|
||||||||||| |
|
|
| T |
19974290 |
aggcataaggt |
19974300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 197 - 309
Target Start/End: Original strand, 19974357 - 19974474
Alignment:
| Q |
197 |
aggggaattaaatagacaaa-----agcacacgaaacatacaaggttgcatcattatgatgacttgaaaaatccttgagcttagcttgattatcggcagt |
291 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19974357 |
aggggaattaaatagacaaactgtgagcacacgatacatacaaggttacatcattatgatgacttgaaaaatccttgagcttagcctgattatcggcagt |
19974456 |
T |
|
| Q |
292 |
attagatgcatgaacagc |
309 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19974457 |
attagatgcatgaacagc |
19974474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 19973959 - 19973996
Alignment:
| Q |
3 |
taaaatcaccaaagcaactgaaattcagaactagatga |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19973959 |
taaaatcaccaaagcaactgaaattcagaactagatga |
19973996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 269 - 312
Target Start/End: Complemental strand, 19622187 - 19622144
Alignment:
| Q |
269 |
agcttagcttgattatcggcagtattagatgcatgaacagcaga |
312 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
19622187 |
agcttagcctgattatcagcagtattagatgaatgaacagcaga |
19622144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University